Jueves, 21 de agosto de 2014
Listeria monocytogenes

Autor: Margolles Barros, Abelardo

Thirty isolates of Listeria monocytogenes and 18 of L. innocua obtained from different short-ripened cheeses manufactured in Asturias (northern Spain), were compared with each other and with reference strains using serotype, phage type and pulsed-field restriction endonuclease digestion profiles analysis of the total DNA. Restriction enzymes ApaI and SmaI defined five clusters in L. monocytogenes (m1 to m5) and two main clusters in L. innocua (i1 and i2). Cluster i2 was further arranged into three subclusters (i2a, i2b and i2c) based on the different Eco52I (XmaIII) and Crf42I (SacII) patterns of its isolates. Clusters of L. innocua were clearly different whereas those of L. monocytogenes were more closely related to each other. In this latter species, serotype 4b isolates (m4 and m5) constituted a more homogeneous group than serogroup 1 isolates (m1, m2 and m3). Cluster m3 contained two strains of serotype 1/2a whereas m1 and m2 harboured strains of both serotypes, 1/2a and 1/2b. Therefore, the combined use of restriction patterns and serotype may be useful to differentiate L. monocytogenes strains showing identical restriction profiles but differing in serotype. The cheese source of Listeria strains proved that isolates from cluster m1 were repeatedly detected as a contaminant in the same type of cheese. Comparison of L. monocytogenesApaI profiles showed a genetic proximity of m4 and m5 to the recognized pathogenic strains ATCC 13932 and NCTC 11994, responsible for meningitis cases in other countries. Finally, bacteriophage typing data indicated that m4, the sole phage typable group, had a phage type resembling that of strains causing the Auckland (New Zealand) outbreak of listeriosis in 1969. These data suggest a wide distribution of closely related types which might cause, under several circumstances, sporadic cases of listeriosis

Autor: Miranda G,Gonzalo

An unusual number of cases of rhomb encephalitis have occurred in Chile because of the increased frequency of infections caused by Listeria monocytogenes. We report three females aged 36, 40 and 55 years, with the disease. All presented with a prodrome characterized by headache, nausea, vomiting and fever, followed by ataxia and unilateral palsies of the third, seventh and twelfth cranial nerves. One patient presented also a hemi-hypoesthesia. Magnetic resonance showed lesions in the posterior aspect of the brain stem, specifically in relation to the floor of the fourth ventricle. Blood cultures were positive for Listeria monocytogenes.

Autor: Burbano,Edith

Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk. Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of 100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percent of the predictive value for PCR (alternative method) provides high reliability, and allows the detection of the positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.

Autor: de Curtis,María Luisa

La demanda de vegetales mínimamente procesados se ha incrementado debido en parte al auge de los servicios de comida, donde las ensaladas siempre están incluidas en los menúes diarios. Las nuevas técnicas de procesamiento y envase que permiten utilizar el producto listo para servir, han aumentado el riesgo asociado con microorganismos patógenos emergentes, tales como Listeria monocytogenes. En el presente trabajo se determinó la presencia de esta especie en 120 muestras de vegetales con procesamiento mínimo (ready-to-use), utilizados en servicios masivos de comida, y adicionalmente, se evaluó la calidad microbiológica a través de la numeración de bacterias aerobias mesófilas, coliformes totales, fecales y Escherichia coli, e investigación de la presencia de Shigella spp y Vibrio cholerae. Para la investigación y detección de L. monocytogenes se utilizó la técnica TECRA® UNIQUE TM LISTERIA, el sistema BCMÒ Listeria monocytogenes, el sistema API LISTERIA y los métodos de detección moleculares AccuProbeTM y GENE-TRAK®. E. coli se detectó en aproximadamente el 30,3% de los vegetales usados en este estudio. El género Listeria, se evidenció en el 25% de las muestras en estudio: 30% correspondió a L. monocytogenes. Estos resultados permiten reafirmar la importancia del control microbiológico de los vegetales para el aseguramiento de la calidad de los mismos.

Autor: Pellicer,Karina

Listeria monocytogenes es el agente causal de Listeriosis en humanos, siendo los alimentos “listos para comer” una de las principales vías de transmisión. El pH óptimo de desarrollo de L. monocytogenes es entre 6 y 9, tolerando hasta pH 4,4. El objetivo fue estudiar el comportamiento in vitro de 30 cepas de Listeria spp. aisladas de alimentos, modificando el pH por adición de HCl y ácido láctico. Se utilizó caldo cerebro corazón al que se le agregó HCl ó ácido láctico hasta pH de 4,8, 5,2, 5,5, 5,8 y 6. Con HCl a pH 4,8 se desarrolló una cepa de L. monocytogenes tipo 1, a pH 5,5 se desarrollaron el 50% de las cepas. Con ácido láctico, a pH 4,8 no hubo desarrollo. A pH 5,8 y 6 con ambos ácidos se desarrollaron la mayoría de las Listerias analizadas. El ácido láctico presentó mayor efecto inhibidor que HCl.

Autor: Bravo M,Mauricio

We report a previously healthy 44 years old female, that presented with mild clouding of consciousness, a left cerebellar syndrome, involvement of V, X and XII left cranial nerves and an alteration of epicritic sensitivity in the left half of the body. Cerebrospinal fluid had inflammatory features. Cerebrospinal fluid and blood cultures were positive for Listeria monocytogenes. Magnetic resonance imaging disclosed a rhomboencephalitis. Antibiotics were started and the clinical condition of the patient improved progressively. After three months of follow up, the patient is notably recovered and there is a regression of hyperintense lesions of the brainstem in the magnetic resonance imaging. The diagnosis of Listeria monocytogenes infection must be born in mind in the presence of a rhomboencephalitis.

Autor: Medrano,Mayra Viviana

Introducción. Listeria monocytogenes es un patógeno emergente adquirido por el consumo de alimentos contaminados. Causa una enfermedad llamada listeriosis, cuya tasa de mortalidad a nivel mundial varía entre 20% y 30%, alcanzando hasta un 80% en casos de infecciones neonatales. La técnica del ADN polimorfo amplificado aleatorio permite distinguir entre diferentes aislamientos y caracterizarlos molecularmente, lo cual aporta información útil acerca de la diversidad de este patógeno en Colombia. Objetivo. Caracterizar molecularmente diferentes aislamientos de L. monocytogenes aisladas de muestras clínicas y alimentos utilizando ésta técnica para determinar posibles relaciones entre estos dos orígenes. Materiales y métodos. Se analizaron 38 aislamientos de L. monocytogenes; 22 de muestras clínicas y 16 de alimentos y plantas procesadoras de alimentos utilizando dos oligonucléotidos de 10pb (HLWL-74 y Arbitrario). Los datos se analizaron utilizando los programas Quantity One y SYN-TAX. Resultados. Se detectó un alto porcentaje de polimorfismo mediante los oligonucleótidos HLWL-74 (81,81%) y Arbitrario (85,71%). Se pudieron describir dos linajes superiores luego del análisis, los cuales se dividieron a su vez en cuatro grupos mayores (A, B C y D) donde se observó una gran diversidad genética. La mayoría de aislamientos clínicos se agruparon bajo el mismo grupo y se encontraron alejados de los aislamientos de alimentos. Conclusión. Los resultados de este estudio demuestran que existe una gran diversidad de polimorfismos de ADN entre los aislamientos de L. monocytogenes que circulan en Colombia, lo que podría reflejar diferencias a nivel fenotípico y patogénico en estos aislamientos.

Autor: López Montes,A.

Presentamos un caso de una paciente con nefropatía lúpica de 20 años de evolución en tratamiento con esteroides que desarrolló una meningoencefalitis asociada a bacteriemia por Listeria monocytogenes. La paciente recibió tratamiento antibiótico con ampicilina y gentamicina durante 6 semanas con excelentes resultados. La infección por Listeria monocytogenes afecta predominantemente a pacientes con cierto grado de inmunosupresión, como pacientes con lupus eritematoso sistémico, con una mortalidad alrededor del 30%.

Autor: Puertollano,M.ª A.

Algunas dietas lipídicas están implicadas en la reducción de ciertas funciones inmunes. Sin embargo, la acción inmunosupresora de estas dietas puede tener efectos adversos sobre la resistencia inmune del individuo frente a enfermedades de naturaleza infecciosa. En el presente estudio tratamos de valorar el estado inmune de ratones alimentados con dietas lipídicas e infectados experimentalmente con una cepa virulenta de Listeria monocytogenes. Ratones de la raza Balb/c fueron divididos en cuatro grupos alimentados cada uno de ellos con su respectiva dieta: dieta baja en lípidos (control, 2,5%), dieta rica en aceite de oliva (AO, 20%), dieta rica en aceite de pescado (AP, 20%) y dieta rica aceite de coco (AC, 20%). Los animales fueron alimentados durante un mes y posteriormente infectados con L. monocytogenes por vía endovenosa. Los resultados han mostrado una reducción de la supervivencia en animales alimentados con AP, así como un incremento significativo en el número de bacterias viables aisladas a partir de bazo. Además hemos podido observar un aumento de la capacidad bactericida de células peritoneales procedentes de ratones alimentados con AO, aunque la invasividad de L. monocytogenes en este grupo fue mayor que en el resto. Finalmente, una reducción significativa de la linfoproliferación fue observada en el grupo alimentado con AP, mientras que la actividad de células natural killer (NK) no se ha visto modificada. Estos resultados indican que dietas lipídicas constituidas por ácidos grasos poliinsaturados de la serie n-3 reducen la resistencia inmune de los ratones, mientras que una dieta constituida por AO no produce un efecto inmusupresor tan relevante y por consiguiente no reduce drásticamente la resistencia inmune siendo más eficiente en la eliminación de L. monocytogenes.

Autor: Bravo M,Mauricio

We report a previously healthy 44 years old female, that presented with mild clouding of consciousness, a left cerebellar syndrome, involvement of V, X and XII left cranial nerves and an alteration of epicritic sensitivity in the left half of the body. Cerebrospinal fluid had inflammatory features. Cerebrospinal fluid and blood cultures were positive for Listeria monocytogenes. Magnetic resonance imaging disclosed a rhomboencephalitis. Antibiotics were started and the clinical condition of the patient improved progressively. After three months of follow up, the patient is notably recovered and there is a regression of hyperintense lesions of the brainstem in the magnetic resonance imaging. The diagnosis of Listeria monocytogenes infection must be born in mind in the presence of a rhomboencephalitis.

Autor: Margolles Barros, Abelardo

The plasmid content of 30 isolates of Listeria monocytogenes and 18 isolates of Listeria innocua obtained from short-ripened cheeses was analysed. The isolates of L. monocytogenes serogroup 1 harboured a single plasmid, pLM33 (33.2 kbp), whereas the serogroup 4 isolates did not contain plasmids. One group of L. innocua strains harboured the plasmid pLI71 (71 kbp) and another one contained two plasmids: pLI59 (59.5 kbp) and pLI56 (56.5 kbp). These plasmid groups were in accordance with clusters previously defined by pulsed-field gel electrophoresis analysis of the chromosomal DNA of Listeria isolates. Plasmids pLM33, pLI71 and pLI59 shared homology regions of at least 20 kbp. Plasmid pLI56 did not encode genes for any known character (such as carbohydrate fermentation, resistance to antibiotics, heavy metals or disinfectants, growth at low pH, NaCl tolerance or thermal inactivation by pasteurisation) and displayed different characteristics to the other three plasmids. It was also the only one cured from the parent strain and the sole plasmid not digested by the restriction enzyme PstI. In addition, its lack of homology with pLM33, pLI71 and pLI59 enhanced the possibility of a different origin for plasmid pLI56.

Autor: Sáa Ibusquiza, Paula

Título tesis: Biofilm formation by Listeria monocytogenes. Resistance to industrial biocides and cross-response caused by adaptation to benzalkonium chloride.
Autor: Paula Saá Ibusquiza
Directores: Marta López Cabo, Juan José Rodríguez Herrera.
Introducción.
Características biológicas:L. monocytogenes es un bacilo Gram positivo, anaerobio facultativo, móvil a temperaturas inferiores a 25 ºC (Seeliger and Jones, 1986) y altamente resistente en condiciones de estrés: pHs ácidos, baja aw, bajas concentraciones de O2 y baja temperatura (Ross et al., 2000, Kathariou, 2002). Todo ello contribuye a su ubicuidad (Cox et al. 1989, Ivanek et al. 2006) y a su condición de bacteria patógena, causante de listeriosis.
Patogeneidad: está asociada a un grupo de riesgo constituido por mujeres embarazadas, individuos de avanzada edad e inmunodeprimidos. A pesar de su ubicuidad, la incidencia anual de listeriosis es de 0.3 casos al año por cada 100.000 habitantes, baja si la comparamos con otras infecciones trasmitidas por alimentos (EFSA 2006). Lo que contrasta con su elevada tasa de mortandad (20-30%), haciéndola especialmente relevante.
Incidencia en alimentos: Las últimas inspecciones realizadas en Europa mostraron una mayor incidencia en productos de la pesca listos para el consumo, en los cuales se detectaron una mayor proporción de muestras contaminadas por encima de 100 UFC/g (2.4%) (EFSA, 2009), sobre todo durante y después del procesado (Cox et al., 1989; Hu et al., 2006; Samelis and Metaxopoulos, 1999, Autio et al., 1999, Miettinen et al., 1999; Norton et al., 2001; Rørvik et al., 1995; Vogel et al., 2001a, Wulff et al., 2006).
Control: Dada la importancia del este patógeno en el ámbito alimentario, se han desarrollado diferentes estrategias para el control de Listeria monocytogenes a diferentes niveles, desde la consideración de medidas para evitar su aparición mediante la implementación del sistema de prerrequisitos y análisis de riesgo de los puntos críticos de control (HACCP), hasta el diseño de estrategias de conservación que aseguren el control de L. monocytogenes, pasando además por los esfuerzos realizados en la aplicación de protocolos de limpieza y desinfección efectivos.
Justificación:
Listeria monocytogenes es uno de los patógenos más importantes transmitidos por los alimentos, ya que tiene un alta incidencia en diferentes tipos de productos alimenticios, incluidos los productos de la pesca, y puede causar enfermedades graves e incluso la muerte en personas susceptibles. En términos generales, este trabajo se justifica por la necesidad de reducir el riesgo de la presencia de L. monocytogenes en los alimentos. Dentro de este objetivo global tres razones principales apoyar la adecuación de los objetivos específicos planteados en esta tesis doctoral:

Autor: Arias Miranda,I. M.

La Listeria monocytogenes (LM) continúa siendo una rara infección oportunista en enfermos inmunodeprimidos. Se presentan las características clinicoepidemiológicas y terapéuticas de 10 casos de infección por LM, siendo estas 4 bacteriemias primarias, 3 meningitis, 2 peritonitis bacterianas espontáneas y 1 absceso abdominal. Todos tenían factores predisponentes. Las formas de presentación más frecuentes fueron el cuadro séptico y la meningoencefalitis. El antibiótico más utilizado fue la ampicilina. La mortalidad global fue de un 40%.

Autor: Selma, María Victoria

Fresh vegetables contaminated with Yersinia enterocolitica have been implicated in foodborne disease outbreaks. Surfaces of vegetables can become contaminated with pathogenic microorganisms through contact with soil, irrigation water, fertilizers, equipment, humans, and animals. One approach to reduce this contamination is to treat fresh produce with sanitizers. In this study, the ability of ozone to inactivate Y. enterocolitica inoculated in water and on potato surfaces was evaluated. Furthermore, the efficacy of ozone in reducing natural flora on whole potato was determined. Total aerobic mesophilic and psychrotrophic bacteria, total coliforms, and Listeria monocytogenes were enumerated. Finally, several disinfection kinetic models were considered to predict Y. enterocolitica inactivation with ozone. Treatments with ozone (1.4 and 1.9 ppm) for 1 min decreased the Y. enterocolitica population in water by 4.6 and 6.2 log CFU ml−1, respectively. Furthermore, ozonated water (5 ppm) for 1 min decreased Y. enterocolitica and L. monocytogenes from potato surfaces by 1.6 and 0.8 log CFU g−1, respectively. Therefore, ozone can be an effective treatment for disinfection of wash water and for reduction of potato surface contamination.

Autor: Zamora,Juan Manuel

El uso actual de los antibióticos no se da únicamente con fines terapéuticos, sino que se ha extendido hacia la prevención de enfermedades y como promotores del crecimiento en animales. Esta prácticas han llevado a la propagación de resistencia a antibióticos, lo cual representa un riesgo en Salud Pública. En el presente estudio, se evaluó el perfil de sensibilidad a antibióticos de 20 cepas de Listeria monocytogenes y 40 cepas de Salmonella spp. aisladas a partir de alimentos y se comparó con los perfiles de sensibilidad de 20 cepas de L. monocytogenes y 100 de Salmonella sp de origen clínico. El 95% de las cepas de L. monocytoges aisladas a partir de alimentos fue sensible a ampicilina, comparado con el 65% de las cepas de origen clínico. De la misma manera, el 100% de las cepas alimentarias mostraron sensibilidad a la gentamicina, comparado en el 85% de las cepas clínicas. El 95% de ambas mostró sensibilidad a tripetropin sulfametoxazol y el 100% a ciprofloxacina. Con respecto a Salmonella spp., para los antibióticos trimetoprim sulfametoxazol, gentamicina, ciprofloxacina, ácido nalidíxico y amoxicilina/ácido clavulánico, los porcentajes de sensibilidad fueron similares, sin embargo, las cepas de origen alimentario mostraron un 97,5% y un 82.5% de sensibilidad a la tetraciclina y cefalexina respectivamente, comparado con un 83 y 90% obtenido a partir de las cepas de origen clínico. Los resultados obtenidos ponen de manifiesto el riesgo potencial que representan las cepas bacterianas aisladas de alimentos en la transmisión de resistencia a los antibióticos.

Autor: Aymerich,N.

La rombencefalitis por Listeria es una infección grave e infrecuente del tronco cerebral. Afecta principalmente a sujetos previamente sanos. Clínicamente se manifiesta en dos fases: la primera con síntomas inespecíficos, de una semana aproximadamente de duración y la segunda con aparición de signos de focalidad neurológica a nivel del tronco cerebral. Presentamos el caso de un paciente con rombencefalitis por Listeria que inicialmente debutó con cefalea, náuseas y fiebre y a los diez días comenzó con afectación de pares craneales asimétrica, signos cerebelosos y alteraciones sensitivas en hemicuerpo izquierdo. Posteriormente se complicó con insuficiencia respiratoria aguda que precisó ingreso en Unidad de Cuidados Intensivos y con episodios de retención urinaria que requirieron sondaje. En la resonancia magnética cerebral realizada de forma precoz se objetivaron lesiones parcheadas hiperintensas en secuencias T2 al nivel de bulbo y protuberancia. Ante la sospecha clínico-radiológica de rombencefalitis por Listeria se inició tratamiento con ampicilina y tobramicina. A los días se detectó hemocultivo positivo para Listeria monocytogenes serotipo 4B resistente a ampicilina, por lo que se sustituyó por vancomicina. El paciente sobrevivió quedando al alta como secuelas trastorno oculomotor y molestias miccionales. Como conclusión destacamos la importancia del reconocimiento temprano de los signos clínicos de la enfermedad y de la realización de forma precoz de resonancia magnética, como apoyo diagnóstico, para poder instaurar lo antes posible el tratamiento antibiótico adecuado.

Autor: Guevara, Leymaya

Stochastic models are useful for estimating the risk of foodborne illness and they can be integrated, besides other sources of variability, into microbial risk assessment. A stochastic approach to evaluate growth of two strains of Listeria monocytogenes influenced by different factors affecting microbial growth (pH and storage temperature) was performed. An individual-based approach of growth through optical density measurements was used. From results obtained, histograms of the lag phase were generated and distributions were fitted. Histograms presented increased variation when the factors applied were suboptimal for L. monocytogenes and they were combined. The extreme value distribution was ranked as the best one in most cases, whereas normal was the poorest fitting distribution. To evaluate the influence of pH and storage temperature on L. monocytogenes CECT 5672 in real food, commercial samples of courgette and carrot soup were inoculated with this pathogen. It was able to grow in both soups at storage temperatures from 4°C to 20°C. Using the distributions adjusted, predictions of time to growth (102 cfu/g) of L. monocytogenes were established by Monte Carlo simulation and they were compared with deterministic predictions and observations in foods.

Autor: Barrantes,Xinia

Se estudió el efecto de cultivos probióticos sobre Listeria monocytogenes y Escherichia coli O157:H7 inoculados en yogurt durante su almacenamiento. En tres ocasiones diferentes, dos distintas marcas comerciales de yogurt, una con probióticos adicionales (Lactobacillus casei y L. acidophilus) fueron inoculadas con una población conocida (10(6) UFC/g) de L. monocytogenes o E. coli O157: H7 y almacenadas a 5ºC por 32 días. Cada cuatro días se realizó un recuento de bacterias lácticas, de los patógenos agregados y se determinó el pH, de acuerdo a la metodología descrita en el Bacteriological Analytical Manual. El número de bacterias lácticas y el pH se mantuvieron constantes durante el período de evaluación. El yogurt con probióticos adicionales redujo la población de L. monocytogenes a niveles no detectables en 8 días de almacenamiento, la población de E. coli O157:H7 en 16 días; el yogurt sin probióticos adicionales tardó 20 días en reducir la población de L. monocytogenes a niveles no detectables y aún después de 28 días de almacenamiento, se pudo cultivar la E. coli O157:H7. En este trabajo, se confirma de nuevo los efectos beneficiosos de los cultivos probióticos adicionales en yogurt.

Autor: Bravo M,Mauricio

We report a previously healthy 44 years old female, that presented with mild clouding of consciousness, a left cerebellar syndrome, involvement of V, X and XII left cranial nerves and an alteration of epicritic sensitivity in the left half of the body. Cerebrospinal fluid had inflammatory features. Cerebrospinal fluid and blood cultures were positive for Listeria monocytogenes. Magnetic resonance imaging disclosed a rhomboencephalitis. Antibiotics were started and the clinical condition of the patient improved progressively. After three months of follow up, the patient is notably recovered and there is a regression of hyperintense lesions of the brainstem in the magnetic resonance imaging. The diagnosis of Listeria monocytogenes infection must be born in mind in the presence of a rhomboencephalitis.

Autor: Villalobos de B,Luz Bettina

El queso artesanal es uno de los alimentos que tiene poca supervisión sanitaria durante su elaboración y comercialización. Como se ha visto involucrado en brotes de ETA en Venezuela, y en otros países está asociado a listeriosis, en el presente trabajo se investigó la presencia de Listeria monocytogenes en quesos frescos que se expenden en comercios públicos y municipales de Cumaná. Se analizaron 60 muestras de quesos frescos determinándose los porcentajes de NaCl y pH. El aislamiento y caracterización bioquímica de las cepas de Listeria spp se realizaron según la FDA y API Listeria y molecularmente por PCR Los valores de pH oscilaron entre 3,81 y 7,10 con un promedio de 5,87, el porcentaje de NaCl osciló entre 0,58 y 7,60, con media 2,20. Diez muestras fueron positivas por pruebas bioquímicas convencionales y API Listeria para el genero Listeria. En la confirmación por PCR, se identificaron 2 L. monocytogenes, 2 positivas para el grupo L.welshimeri- L.selligeri-L.ivanovii y 5 cepas identificadas como L. innocua y 1 L.grayi Las dos L. monocytogenes, fueron positivas para gen de la listeriolisina (hly). Los datos aportan evidencia de fallas en la elaboración de los quesos artesanales por la gran dispersión en los valores de NaCl y pH, además con este estudio se confirma que Listeria monocytogenes puede encontrarse contaminando alimentos de alto consumo en el país.