Jueves, 24 de abril de 2014
Listeria monocytogenes

Autor: Medrano,Mayra Viviana

Introducción. Listeria monocytogenes es un patógeno emergente adquirido por el consumo de alimentos contaminados. Causa una enfermedad llamada listeriosis, cuya tasa de mortalidad a nivel mundial varía entre 20% y 30%, alcanzando hasta un 80% en casos de infecciones neonatales. La técnica del ADN polimorfo amplificado aleatorio permite distinguir entre diferentes aislamientos y caracterizarlos molecularmente, lo cual aporta información útil acerca de la diversidad de este patógeno en Colombia. Objetivo. Caracterizar molecularmente diferentes aislamientos de L. monocytogenes aisladas de muestras clínicas y alimentos utilizando ésta técnica para determinar posibles relaciones entre estos dos orígenes. Materiales y métodos. Se analizaron 38 aislamientos de L. monocytogenes; 22 de muestras clínicas y 16 de alimentos y plantas procesadoras de alimentos utilizando dos oligonucléotidos de 10pb (HLWL-74 y Arbitrario). Los datos se analizaron utilizando los programas Quantity One y SYN-TAX. Resultados. Se detectó un alto porcentaje de polimorfismo mediante los oligonucleótidos HLWL-74 (81,81%) y Arbitrario (85,71%). Se pudieron describir dos linajes superiores luego del análisis, los cuales se dividieron a su vez en cuatro grupos mayores (A, B C y D) donde se observó una gran diversidad genética. La mayoría de aislamientos clínicos se agruparon bajo el mismo grupo y se encontraron alejados de los aislamientos de alimentos. Conclusión. Los resultados de este estudio demuestran que existe una gran diversidad de polimorfismos de ADN entre los aislamientos de L. monocytogenes que circulan en Colombia, lo que podría reflejar diferencias a nivel fenotípico y patogénico en estos aislamientos.

Autor: Bizani,Delmar

The mode of action of cerein 8A, a bacteriocin produced by the soil bacterium Bacillus cereus 8A, was investigated. The effect of cerein 8A was tested against Listeria monocytogenes and a bactericidal effect at 400 arbitrary units (AU)/ml was observed. In addition, cerein 8A was bactericidal against Bacillus cereus at 200 AU/ml, and inhibited the growth of Escherichia coli and Salmonella Enteritidis. Stronger inhibition of these gram-negative bacteria was achieved when the chelating agent EDTA was added together with bacteriocin. The effect of cerein 8A on B. cereus and L. monocytogenes was also investigated by Fourier transform infrared spectroscopy (FTIR). Treated cells had an important frequency increase at 2920 cm-1 and a decrease at 1400 cm-1, corresponding to assignments of fatty acids. Transmission electron microscopy showed damaged cell walls and loss of protoplasmic material. These results suggest that the mode of action of cerein 8A is to interfere with cell membranes and the cell wall.

Autor: Guevara, Leymaya

Stochastic models are useful for estimating the risk of foodborne illness and they can be integrated, besides other sources of variability, into microbial risk assessment. A stochastic approach to evaluate growth of two strains of Listeria monocytogenes influenced by different factors affecting microbial growth (pH and storage temperature) was performed. An individual-based approach of growth through optical density measurements was used. From results obtained, histograms of the lag phase were generated and distributions were fitted. Histograms presented increased variation when the factors applied were suboptimal for L. monocytogenes and they were combined. The extreme value distribution was ranked as the best one in most cases, whereas normal was the poorest fitting distribution. To evaluate the influence of pH and storage temperature on L. monocytogenes CECT 5672 in real food, commercial samples of courgette and carrot soup were inoculated with this pathogen. It was able to grow in both soups at storage temperatures from 4°C to 20°C. Using the distributions adjusted, predictions of time to growth (102 cfu/g) of L. monocytogenes were established by Monte Carlo simulation and they were compared with deterministic predictions and observations in foods.

Autor: Cháves,Carolina

En Costa Rica, cerca del 25% de la producción de leche nacional es utilizada en la elaboración de queso tierno no pasteurizado, y el consumo de este producto es aproximadamente de 4 a 5 kg anuales per cápita. Este alimento ha sido involucrado en brotes debidos a Listeria monocytogenes. Dado lo anterior, se aisló e identificó esta bacteria a partir de muestras de queso blanco no pasteurizado provenientes de dos zonas tradicionalmente productoras y expendedoras de dicho producto. Se recolectaron 110 muestras de queso a partir de las cuales se aislaron 27 cepas de L. monocytogenes. Las cepas fueron caracterizadas mediante pruebas bioquímicas y serológicas, además se les realizaron pruebas de susceptibilidad a los antibióticos, hemólisis en tubo e invasión en células Hela. El 85% de las cepas evaluadas fueron sensibles a todos los antibióticos analizados, no obstante, cuatro cepas (15%) presentaron patrones de resistencia a diversos agentes, incluyendo estreptomicina, kanamicina, cefalotina y tetraciclina. También, se encontraron patrones de resistencia múltiple. El 88,9% de los aislamientos estudiados fueron positivos para la prueba de hemólisis en tubo, y el 22,2% presentaron porcentajes de invasión iguales o superiores a la cepa de origen clínico usada como control. Cabe destacar que todas las cepas con capacidad de invasión fueron también susceptibles a todos los antibióticos usados. Los resultados encontrados ponen de manifiesto la presencia de L. monocytogenes en queso blanco de origen costarricense. También se evidencia un alto porcentaje de susceptibilidad a los antibióticos de uso común para los casos de listeriosis. Por otro lado, pone de manifiesto que el queso blanco puede ser transmisor de cepas con capacidad de invasión y por ende, potencialmente patógenas al hombre.

Autor: Barrantes,Xinia

Se estudió el efecto de cultivos probióticos sobre Listeria monocytogenes y Escherichia coli O157:H7 inoculados en yogurt durante su almacenamiento. En tres ocasiones diferentes, dos distintas marcas comerciales de yogurt, una con probióticos adicionales (Lactobacillus casei y L. acidophilus) fueron inoculadas con una población conocida (10(6) UFC/g) de L. monocytogenes o E. coli O157: H7 y almacenadas a 5ºC por 32 días. Cada cuatro días se realizó un recuento de bacterias lácticas, de los patógenos agregados y se determinó el pH, de acuerdo a la metodología descrita en el Bacteriological Analytical Manual. El número de bacterias lácticas y el pH se mantuvieron constantes durante el período de evaluación. El yogurt con probióticos adicionales redujo la población de L. monocytogenes a niveles no detectables en 8 días de almacenamiento, la población de E. coli O157:H7 en 16 días; el yogurt sin probióticos adicionales tardó 20 días en reducir la población de L. monocytogenes a niveles no detectables y aún después de 28 días de almacenamiento, se pudo cultivar la E. coli O157:H7. En este trabajo, se confirma de nuevo los efectos beneficiosos de los cultivos probióticos adicionales en yogurt.

Autor: Miranda G,Gonzalo

An unusual number of cases of rhomb encephalitis have occurred in Chile because of the increased frequency of infections caused by Listeria monocytogenes. We report three females aged 36, 40 and 55 years, with the disease. All presented with a prodrome characterized by headache, nausea, vomiting and fever, followed by ataxia and unilateral palsies of the third, seventh and twelfth cranial nerves. One patient presented also a hemi-hypoesthesia. Magnetic resonance showed lesions in the posterior aspect of the brain stem, specifically in relation to the floor of the fourth ventricle. Blood cultures were positive for Listeria monocytogenes.

Autor: Larraín de la C,Demetrio

Listeria monocytogenes es un bacilo grampositivo, intracelular facultativo, que se encuentra ampliamente difundido en la naturaleza, frecuentemente en alimentos. Las infecciones afectan principalmente a pacientes inmunocomprometidos, ancianos, mujeres embarazadas y neonatos. La infección intrauterina puede producir importantes complicaciones como corioamnionitis, parto de pre-término, aborto espontáneo de primer o segundo trimestre, mortinatos y sepsis neonatal. En el período 2001-2005, 16 pacientes con infección por L. monocytogenes fueron identificados en nuestro hospital. Cuatro de ellos (25%) se presentaron en mujeres embarazadas; se describen sus características clínicas y de laboratorio. Hubo tres partos de pre-término y un aborto espontáneo de segundo trimestre. En tres de las cuatro pacientes, el único factor de riesgo fue el embarazo. Una paciente recibía terapia inmunosupresora por una colitis ulcerosa. Fiebre fue el síntoma más frecuente. El compromiso feto-neonatal se manifestó por listeriosis neonatal precoz (dos casos) y mortinato (un caso). El embarazo puede ser el único factor predisponente a desarrollar listeriosis. Ésta debe considerarse en la evaluación del síndrome febril de una mujer embarazada. Los cultivos de sangre y líquido amniótico son útiles para su diagnóstico. La tasa de complicaciones perinatales permanece elevada.

Autor: Chanqueo C,Leonardo

L. monocytogenes infections are infrequent. Sepsis in pregnant women and newborns and central nervous system infections in the elderly are the most common clinical manifestations. We report a 61 years old woman with diabetes Mellitus and a Child B hepatic cirrhosis, admitted for persistent fever. Blood cultures were positive for Listeria monocytogenes. Cerebrospinal fluid was normal and sterile. She was treated with ampicillin and amikacin with a good response. Control blood cultures were negative. She was discharged 14 days after in good conditions

Autor: PERALTA MADARIAGA, ANA KARINA

Un total de 30 cepas de L. monocytogenes fueron aisladas de productos agropecuarios chilenos como vegetales congelados, alimentos frescos, carnes rojas, cecinas, pescados, condimentos y alimentos listos para su consumo durante los meses de Julio y Agosto del 2009.
La caracterización bioquímica y molecular de las cepas se realizó por perfil bioquímico, PCR y determinación del gen de virulencia lmo2821. El 100% de las cepas aisladas e identificadas por método bioquímico según protocolo estándar recomendado por la Norma ISO 11290-1:1996, fueron confirmadas también como L. monocytogenes por análisis de PCR. De ellas el 93,3% presentaban la secuencia específica del gen de virulencia lmo2821.

Autor: Chanqueo C,Leonardo

L. monocytogenes infections are infrequent. Sepsis in pregnant women and newborns and central nervous system infections in the elderly are the most common clinical manifestations. We report a 61 years old woman with diabetes Mellitus and a Child B hepatic cirrhosis, admitted for persistent fever. Blood cultures were positive for Listeria monocytogenes. Cerebrospinal fluid was normal and sterile. She was treated with ampicillin and amikacin with a good response. Control blood cultures were negative. She was discharged 14 days after in good conditions

Autor: Selma, María Victoria

Fresh vegetables contaminated with Yersinia enterocolitica have been implicated in foodborne disease outbreaks. Surfaces of vegetables can become contaminated with pathogenic microorganisms through contact with soil, irrigation water, fertilizers, equipment, humans, and animals. One approach to reduce this contamination is to treat fresh produce with sanitizers. In this study, the ability of ozone to inactivate Y. enterocolitica inoculated in water and on potato surfaces was evaluated. Furthermore, the efficacy of ozone in reducing natural flora on whole potato was determined. Total aerobic mesophilic and psychrotrophic bacteria, total coliforms, and Listeria monocytogenes were enumerated. Finally, several disinfection kinetic models were considered to predict Y. enterocolitica inactivation with ozone. Treatments with ozone (1.4 and 1.9 ppm) for 1 min decreased the Y. enterocolitica population in water by 4.6 and 6.2 log CFU ml−1, respectively. Furthermore, ozonated water (5 ppm) for 1 min decreased Y. enterocolitica and L. monocytogenes from potato surfaces by 1.6 and 0.8 log CFU g−1, respectively. Therefore, ozone can be an effective treatment for disinfection of wash water and for reduction of potato surface contamination.

Autor: Margolles Barros, Abelardo

The plasmid content of 30 isolates of Listeria monocytogenes and 18 isolates of Listeria innocua obtained from short-ripened cheeses was analysed. The isolates of L. monocytogenes serogroup 1 harboured a single plasmid, pLM33 (33.2 kbp), whereas the serogroup 4 isolates did not contain plasmids. One group of L. innocua strains harboured the plasmid pLI71 (71 kbp) and another one contained two plasmids: pLI59 (59.5 kbp) and pLI56 (56.5 kbp). These plasmid groups were in accordance with clusters previously defined by pulsed-field gel electrophoresis analysis of the chromosomal DNA of Listeria isolates. Plasmids pLM33, pLI71 and pLI59 shared homology regions of at least 20 kbp. Plasmid pLI56 did not encode genes for any known character (such as carbohydrate fermentation, resistance to antibiotics, heavy metals or disinfectants, growth at low pH, NaCl tolerance or thermal inactivation by pasteurisation) and displayed different characteristics to the other three plasmids. It was also the only one cured from the parent strain and the sole plasmid not digested by the restriction enzyme PstI. In addition, its lack of homology with pLM33, pLI71 and pLI59 enhanced the possibility of a different origin for plasmid pLI56.

Autor: Margolles Barros, Abelardo

Thirty isolates of Listeria monocytogenes and 18 of L. innocua obtained from different short-ripened cheeses manufactured in Asturias (northern Spain), were compared with each other and with reference strains using serotype, phage type and pulsed-field restriction endonuclease digestion profiles analysis of the total DNA. Restriction enzymes ApaI and SmaI defined five clusters in L. monocytogenes (m1 to m5) and two main clusters in L. innocua (i1 and i2). Cluster i2 was further arranged into three subclusters (i2a, i2b and i2c) based on the different Eco52I (XmaIII) and Crf42I (SacII) patterns of its isolates. Clusters of L. innocua were clearly different whereas those of L. monocytogenes were more closely related to each other. In this latter species, serotype 4b isolates (m4 and m5) constituted a more homogeneous group than serogroup 1 isolates (m1, m2 and m3). Cluster m3 contained two strains of serotype 1/2a whereas m1 and m2 harboured strains of both serotypes, 1/2a and 1/2b. Therefore, the combined use of restriction patterns and serotype may be useful to differentiate L. monocytogenes strains showing identical restriction profiles but differing in serotype. The cheese source of Listeria strains proved that isolates from cluster m1 were repeatedly detected as a contaminant in the same type of cheese. Comparison of L. monocytogenesApaI profiles showed a genetic proximity of m4 and m5 to the recognized pathogenic strains ATCC 13932 and NCTC 11994, responsible for meningitis cases in other countries. Finally, bacteriophage typing data indicated that m4, the sole phage typable group, had a phage type resembling that of strains causing the Auckland (New Zealand) outbreak of listeriosis in 1969. These data suggest a wide distribution of closely related types which might cause, under several circumstances, sporadic cases of listeriosis

Autor: Bravo M,Mauricio

We report a previously healthy 44 years old female, that presented with mild clouding of consciousness, a left cerebellar syndrome, involvement of V, X and XII left cranial nerves and an alteration of epicritic sensitivity in the left half of the body. Cerebrospinal fluid had inflammatory features. Cerebrospinal fluid and blood cultures were positive for Listeria monocytogenes. Magnetic resonance imaging disclosed a rhomboencephalitis. Antibiotics were started and the clinical condition of the patient improved progressively. After three months of follow up, the patient is notably recovered and there is a regression of hyperintense lesions of the brainstem in the magnetic resonance imaging. The diagnosis of Listeria monocytogenes infection must be born in mind in the presence of a rhomboencephalitis.

Autor: Bravo M,Mauricio

We report a previously healthy 44 years old female, that presented with mild clouding of consciousness, a left cerebellar syndrome, involvement of V, X and XII left cranial nerves and an alteration of epicritic sensitivity in the left half of the body. Cerebrospinal fluid had inflammatory features. Cerebrospinal fluid and blood cultures were positive for Listeria monocytogenes. Magnetic resonance imaging disclosed a rhomboencephalitis. Antibiotics were started and the clinical condition of the patient improved progressively. After three months of follow up, the patient is notably recovered and there is a regression of hyperintense lesions of the brainstem in the magnetic resonance imaging. The diagnosis of Listeria monocytogenes infection must be born in mind in the presence of a rhomboencephalitis.

Autor: Aymerich,N.

La rombencefalitis por Listeria es una infección grave e infrecuente del tronco cerebral. Afecta principalmente a sujetos previamente sanos. Clínicamente se manifiesta en dos fases: la primera con síntomas inespecíficos, de una semana aproximadamente de duración y la segunda con aparición de signos de focalidad neurológica a nivel del tronco cerebral. Presentamos el caso de un paciente con rombencefalitis por Listeria que inicialmente debutó con cefalea, náuseas y fiebre y a los diez días comenzó con afectación de pares craneales asimétrica, signos cerebelosos y alteraciones sensitivas en hemicuerpo izquierdo. Posteriormente se complicó con insuficiencia respiratoria aguda que precisó ingreso en Unidad de Cuidados Intensivos y con episodios de retención urinaria que requirieron sondaje. En la resonancia magnética cerebral realizada de forma precoz se objetivaron lesiones parcheadas hiperintensas en secuencias T2 al nivel de bulbo y protuberancia. Ante la sospecha clínico-radiológica de rombencefalitis por Listeria se inició tratamiento con ampicilina y tobramicina. A los días se detectó hemocultivo positivo para Listeria monocytogenes serotipo 4B resistente a ampicilina, por lo que se sustituyó por vancomicina. El paciente sobrevivió quedando al alta como secuelas trastorno oculomotor y molestias miccionales. Como conclusión destacamos la importancia del reconocimiento temprano de los signos clínicos de la enfermedad y de la realización de forma precoz de resonancia magnética, como apoyo diagnóstico, para poder instaurar lo antes posible el tratamiento antibiótico adecuado.

Autor: Ramírez Mérida,Luís Guillermo

La reacción en cadena de la polimerasa, conocida como PCR, es un método que permite replicar miles de veces, en pocas horas e in vitro, pequeñas cantidades de ADN. La aplicación de métodos rápidos y sensibles, para detectar Listeria monocytogenes en muestras de queso blanco, permitirá un mejor control microbiológico del proceso de producción. Se aplicó PCR a 30 muestras de queso blanco, de una quesera de Valencia Estado Carabobo. Se detectó especificidad y sensibilidad para PCR mediante el empleo de la cepa control Listeria monocytogenes 446. Extracción de ADN según metodología descrita por Torres y col., Marcador de peso molecular de 100 pares de base. Se emplearon: cuatro cebadores del gen hlyA de listeriolisina O; iniciadores L1/U1 para banda 938 pb y LF/LR para banda 750 pb del gen hlyA. Estadístico EpiInfo V6 para concordancia de observaciones en geles, mediante coeficiente Kappa (K). Resultados: 8 de las 30 muestras de queso analizadas, mostraron crecimiento presuntivo de Listeria spp en Agar PALCAM. De las cuales 2 de las muestras no pertenecian al género Listeria; en las 6 restantes las pruebas de confirmación arrojaron que: 2 eran L. monocytogenes, 3 L.ivanovii y 1 L. seeligeri. Mediante PCR 2 muestras resultaron positivas para L. monocytogenes al amplificar la banda 938 pb para Listeria y banda 750 pb para la especie monocytogenes. Se concluye que PCR demostró ser altamente específico y sensible para L. monocytogenes, teniendo ventaja sobre agar PALCAM al evidenciar la presencia especifica del patógeno en un tiempo relativamente corto.

Autor: Abarca V,Katia

La mujer embarazada está expuesta a contraer una variedad de infecciones, tanto bacterianas, como virales y parasitarias, muchas de las cuales implican un riesgo de afectar también al feto y recién nacido. La transmisión de infecciones de la madre al hijo (transmisión vertical) puede ocurrir tanto durante el embarazo como durante el parto y aún después del parto. Este artículo resume ciertas medidas preventivas de probada eficacia contra algunas de estas infecciones, como son la vacunación pre- embarazo contra rubéola, varicela, hepatitis B, difteria-tétanos; o contra influenza durante el embarazo, el estudio serológico de algunas infecciones que cuentan con medidas de prevención de transmisión al hijo (VIH, sífilis, hepatitis B en no vacunadas) y medidas generales para prevenir la toxoplasmosis. Además revisa con mayor detalle las siguientes infecciones: Streptococcus b hemolítico Grupo B, Listeria monocytogenes, Chlamydia trachomatis, herpes genital, varicela y parvovirus. Para cada una de éstas se indican algunos aspectos epidemiológicos, frecuencia y momento de la transmisión vertical, los riesgos para la madre y para el hijo, las medidas terapéuticas para la infección materna y en especial, las medidas preventivas de la transmisión vertical

Autor: Carrillo Zeledón,Gabriela

Listeria monocytogenes, además de ser un género capaz de producir una enfermedad infecciosa grave en el hombre, puede formar biopelículas en distintas superficies relacionadas con el ambiente de producción alimentario. Éstas constituyen un serio problema debido a que son una fuente importante y constante de contaminación para los alimentos y el ambiente de producción, además de que las bacterias presentes en ellas poseen una aumentada resistencia hacia agentes físicos y químicos de uso frecuente. En el presente trabajo se estudió la capacidad de formación de biopelícula de cepas de L. monocytogenes previamente aisladas a partir de queso tierno bajo diferentes condiciones de temperatura y cultivo. Se utilizó una técnica de microplaca con diferentes medios de cultivo (CICC, CTS 1:20 y suero de queso) a diferentes temperaturas de incubación (refrigeración, ambiente y 35ºC). La capacidad de formación de biopelícula fue clasificada según la densidad óptica obtenida a 620 nm. Ninguna de las cepas evaluadas fue clasificada como formadora fuerte de biopelicula bajo ninguna de las variables estudiadas, sí se detectaron formadoras débiles y moderadas. Los resultados obtenidos ponen de manifiesto la influencia del contenido de nutrientes en el medio de cultivo sobre la formación de biopelícula, no obstante, el CICC fue el único medio que permitió la expresión de formadores moderados. Por el contrario, el suero de queso resultó poco favorecedor. La formación de biopelícula es un proceso multifactorial, donde el nivel de adsorción depende de gran cantidad de variables y cuyo estudio debe fomentarse, de manera que se desarrollen metodologías que permitan su reducción o eliminación, de manera que las industrias alimentarias aseguren productos inocuos y de buena calidad microbiológica.

Autor: Burbano,Edith

Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk. Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of 100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percent of the predictive value for PCR (alternative method) provides high reliability, and allows the detection of the positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.